The Beetle D N A Lab

From ZSM Entomology Portal
Jump to: navigation, search

Navigation

Coleoptera Home

Arbeitskreis der bayerischen Käferfreunde

Funding Sources of Beetle Lab

DNA Extraction / Purification

We prefer non-destructive extraction and use a single hind leg (large specimens, e.g. Hydaticus, Cybister), some flight muscle (e.g. Rhantus) or whole beetles, where we will punctuate the metaventrite with a sterile insect pin size 5 several times. We use the Qiagen single column animal tissue kit, or the 96-well-plate kit (Qiagen, Hilden, Germany). We also use the NucleoSpin 96 Tissue Kit (Macherey-Nagel, Düren, Germany), BUT for the latter we use the Qiagen AE buffer for elution because it might have better long-term storage properties!

Protocol:

  • Carefully remove beetle parts on a clean tissue and avoid contaminations (use pins or foreceps)
  • Put each beetle part or a whole specimen into a new 1.5mL tube and transfer the tube into a heater to let the EtOH evaporateat 30-40°C for 20 minutes. A speedvac would make this faster.
  • Premix 180µL of ATL buffer with 20µL of Proteinase K for each sample tube (for 10 samples it would be 1800µL ATL buffer mixed with 200µL of Proteinase K) and pipette a total volume of 200µL of the mix into each sample tube
  • Mix the sample tubes thoroughly by inverting the sample tube rack a few times, use an empty rack as counterpart so that your tubes do not fall down. No need to vortex!!!
  • Transfer the sample tubes into a +56°C water bath for incubation (overnight or at least 2 hours), shake gently a few times every once in a while; or use thermo shaker for the incubation process, if available
  • After the incubation mix the samples again, by thoroughly inverting the sample rack a few times. No need to vortex!!!
  • Premix 200µL AL buffer with 200µL EtOH 96-99% for each sample, pipette a total volume of 400µL of this mix into every sample tube and invert the samples again. No need to vortex!!!
  • Combine the equipped collection tubes with the purification columns (one for each sample you got) – label the columns correctly!!! On your rack, also prepare two empty collection tubes for each sample (you will need these in the next steps).
  • Transfer the liquid of each sample tube (600µL) into the corresponding column and centrifuge the samples for 1 minute at 8000rpm (transfer the beetle parts or the whole specimen now back into the original tubes with EtOH)
  • After centrifugation, transfer columns to a new collection tube (discard the used ones), add 500µL AW1 buffer and centrifuge the samples for 1 minute at 8000rpm (Note: to collect the waste tubes, you can use empty washed milk tetrapacks or juice bottles – whatever has a widemouth and screwcap, this keeps your lab tidy and reduces smelly evaporations from your waste).
  • Afterwards, transfer the columns to a new collection tube (discard the used ones), add 500µL AW2 buffer and centrifuge the samples for 3 minutes at 14000rpm
  • To eluate the DNA, transfer each column on to a new sterile 1.5mL or 2mL Eppendorf tube (label correctly; e.g. DNA MB1234 E1) and add 200µL buffer AE, incubate for 1 minute and centrifuge the samples for 1 minute at 6400rpm (Note: as the column sits in the Eppendorf tube. You cannot close the lid of the Eppendorf tube, this remains open and oriented inwards towards the center of the centrifuge, if you spin too high, the lids tend to tear off).
  • To maximize the yield of DNA the last step is repeated once into a new 1.5mL sample tube (label correctly; e.g. 1234 E2)
  • After the extraction process, store the samples in labeled boxes in the -20°C freezer, in order to avoid fast defragmentation of the DNA. You can store the first elutions in 1.5mL tubes and the second elutions in 96-well plates for example.

PCR, Cycle Sequencing and their Cleanups

For PCR, we mainly use Mango-Taq (Bioline). In exceptional cases, we might resort to Sahara TAQ (XXX) or Ex TAQ (TaKaRa).

PCR Protocol (TaKaRa EX TAQ)

  1. 2.5µL TaKaRa Buffer
  2. 0.75 µL MgCl2 (50mM – Bioline, Luckenwalde, Germany)
  3. 1µL dNTPs (10mM dNTP Mix – TaKaRa)
  4. 1µL of the F primer
  5. 1µL of the R primer
  6. 0.1µL Ex TAQ
  7. 18µL distilled water

PCR Protocol (Bioline Mango TAQ)

  • Prepare the mastermix for the selected gene of interest (see list below) in a 1.5ml tube. The following formula refers to one sample and for multiple samples the corresponding volumes need to be multiplied by the number of samples you got. It may be wise to count one additional sample, in order to have a residual volume of mastermix, just in case. (For 25 samples, for example, multiply the following values with 26). The mastermix consists of the following:
  1. 13.25µL distilled water
  2. 5µL Mango Buffer (5x reaction buffer, coloured – Bioline, Luckenwalde, Germany)
  3. 2µL dNTPs (10mM dNTP Mix – Bioline, Luckenwalde, Germany)
  4. 1.25µL MgCl2 (50mM – Bioline, Luckenwalde, Germany)
  5. 1µL of the F primer
  6. 1µL of the R primer
  7. 0.5µL MangoTAQ (5u/µL – Bioline, Luckenwalde, Germany) (Add the TAQ from freezer to the mastermix last)
  8. *Bioline lead office is in London, UK
  • Mix the mastermix thoroughly by inverting the sample tube
  • Centrifuge the mastermix at 500rpm for 10s
  • Pipette 23µL of the mastermix into a well of a 96-well plate or a 200µL tube of an eight-stripe strip.
  • Add 1µL of your sample DNA into the corresponding well or tube
  • Close the tubes or the 96-well plate (the correct closure is important, in order to avoid evaporation of the mastermix during the PCR)
  • Transfer the samples into the PCR-machine (TProfessional – Biometra, Germany).
  • Start the correct temperature-profile program (list below) in order to initiate the PCR and the amplification of the target gene


  • COX 1 (Hco/Lco – Pat/Jerry)

1’94°C – 5x (30s 94°C – 40s 47°C – 1’72°C) – 30x (30s 94°C – 40s 52°C – 1’72°C) – 10’ 72°C

  • COX 2 (CO2f/George)

1’94°C – 5x (30s 94°C – 40s 47°C – 1’72°C) – 30x (30s 94°C – 40s 52°C – 1’72°C) – 10’ 72°C

  • COB (CB3/CB4)

1’94°C – 5x (30s 94°C – 40s 47°C – 1’72°C) – 30x (30s 94°C – 40s 52°C – 1’72°C) – 10’ 72°C

  • 12s (12sai/12sbi)

3’ 96°C – 35x (30s 94°C – 1’ 48°C – 1’ 72°C) – 10’ 72°C

  • 16s (M14/M223)

3’ 96°C – 35x (30s 94°C – 1’ 48°C – 1’ 72°C) – 10’ 72°C

  • 18s (18s5’/18sb5.0 – 18sai/18sb2.5 – 18sa1.0/18sbi – 18sa2.0/18s3’l)

3’ 96°C – 35x (30s 94°C – 1’ 48°C – 1’ 72°C) – 10’ 72°C

  • H3 (H3aF/H3aR)

5’ 95°C – 35x (30s 95°C – 30s 49°C – 1’ 72°C) – 10’ 72°C

  • H4 (H4F2er/H4F2s)

5’ 95°C – 35x (30s 95°C – 30s 49°C – 1’ 72°C) – 10’ 72°C

  • EF1alpha (372s/747a)

5’ 95°C – 8x (30s 95°C – 1’ 58°C – 1’ 72°C – 30s 95°C – 1’ 58°C – 1’ 72°C – 30s 95°C – 1’ 58°C – 1’ 72°C) – 18x (30s 95°C – 1’42°C – 1’ 72°C)

  • ARK (183F/939R)

3’ 94°C – 35x (30s 94°C – 30s 53°C – 1’ 72°C) – 10’ 72°C

  • Wingless (wg550f/wgA6Rz)

3’ 94°C – 35x (30s 94°C – 30s 50°C – 1’ 72°C) – 10’ 72°C

  • CAD (CD439F/CD688R)

3’ 94°C – 35x (30s 94°C – 30s 50°C – 1’ 72°C) – 10’ 72°C

  • ENO (En37F/En731R)

3’ 94°C – 35x (30s 94°C – 30s 50°C – 1’ 72°C) – 10’ 72°C

  • Alpha-Spectrin (1822F/2053R)

10x (1' 94°C - 1' 55°C - 1' 72°C) - 35x (1' 94°C - 1' 45°C - 1' 72°C) - 10' 72°C

Gelelectrophoresis

To check whether the PCR was successful, an agarose gel is established to check for the presence or absence of correct DNA products in the respective PCR approaches.

Protocol:

  • Weigh in 1.5g of agarose (GTQ agarose – Roth, Germany) in a 250mL Erlenmeyer tube and add 150mL of TAE buffer (Rotiphorese TAE buffer – Roth, Germany) and mix by shaking the tube
  • Transfer the Erlenmeyer tube into a microwave and bring the agarose to boil
  • Add 3 drops of Ethidum bromide (Ethidium bromide 0.025% - Roth, Germany) to the hot agarose, and thoroughly shake the tube
  • Prepare a casting box with an adequate number of combs, in order to establish enough gel pockets for all your samples
  • Pour the agarose into the gel casting box and wait at least 30 minutes until the polymerization is completed
  • After the gel is polymerized, carefully remove the combs, to avoid damages on the gel
  • Fill the electrophoresis chamber (e.g. Sub-cell GT – BioRad, USA) with an adequate volume of TAE buffer
  • Transfer the gel into the electrophoresis chamber, remove air bubbles in the gel pockets carefully with a pipette tip
  • Pipette 3 to 5µL of your PCR product into each gel pocket; leave out at least one position in every row of gel pockets for the DNA ladder (marker) (Easy Ladder – Bioline, Germany)
  • Pipette 2µL of marker into the free position in each row
  • Close the electrophoresis chamber and start the electrophoresis (30 minutes at 90V)
  • Afterwards transfer the gel to a gel documentation device (e.g. a Biodoc Analyze -Biometra, Germany) and take a picture of the gel in order to check the PCR products of your samples

PCR cleanup

This step is important in order to remove the excessive PCR buffer and to gain the purified PCR product.

  • Transfer the samples into a 96-well plate (remove the ones, whose PCR did not work)
  • Premix 2500µL of ice cold EtOH (100%) with 250µL 3M sodium acetate (pH=5.5) (this is the amount of EtOH-sodium acetate you need for one complete 96-well plate) and add 25µL to each well (Note: double that for 2 plates, it is always better to run 2 plates at the same time, as you will have almost perfect balance in the centrifuge, adjust balance by adding small cardboard cuts to the lighter plate, on a lab weighter, until both plates have the same weight).
  • Close the plate with a plate-lid and vortex it, in order to mix the PCR products with the cleaning solution
  • Centrifuge the plate for 30min at 5000rpm
  • The residual liquid in the plate is removed by centrifuging the plate headfirst on top of a folded clean paper towel or several layers of toilet paper (use the thick 4ply to absorb enough liquid – practice first, before cleanup, with an old plate and water to get an idea how much tissue you need for a proper absorbtion) for 1min at 400rpm
  • Repeat once to guarantee that the plate is really dry
  • Washing: 25µL of EtOH (70%) are added to each well
  • Centrifuge the plate for another 10min at 5000rpm
  • The residual liquid in the plate is removed by centrifuging the plate headfirst on top of a folded, clean paper towel or several layers of toilet paper for 1min at 400rpm.
  • Transfer the plate into a +70°C heater for at least 10 to 15min to let evaporate the residual EtOH
  • The purified PCR products are then dissolved in 10, 25 or 50µL distilled water (The amount of water that is used for the dissolving of the PCR product depends on the intensity of the DNA bands, which you can check on the print of the gel documentation device. Such samples with strong and intense bands will be dissolved in 50µL of distilled water, weaker bands will be dissolved in a smaller volume)
  • After some trials with fresh collected and extracted material (weevils with a size of 3-5mm) we recommend these volumes after PCR purification (for PCR Mango Taq has been used):
    Cox1 (5' and 3' fragment): 200-2000µL
    16S: 100-200µL H2O
    18S: 100-200µL H2O
    28S: 100-200µL H2O
    Arginie Kinase: 20µL H2O
    EF1-alpha: 20µL H2O
    Histone 4: 200-2000µL H2O
    Enolase: 50-200µL H2O
    CAD: 50-200µL H2O
  • Seal the plate with an aluminum plate coverage and transfer it into a -20°C freezer for storage

Cycle Sequencing (BigDye-PCR)

Total volume: 5 µL

  • Prepare a mastermix for each primer, forward and reverse, for the selected gene of interest (see list below) in a 1.5ml tube. The following formula refers to one sample and for multiple samples the corresponding volumes need to be multiplied by the number of samples you got. It may be wise to count one additional sample, in order to have a residual volume of mastermix, just in case. (For 25 samples, for example, multiply the following values with 26 and prepare one mastermix for the forward primer and another one for the reverse primer). The mastermix consists of the following:
  1. 4,05 µL distilled water
  2. 0.5 µL Sequence buffer (you can make it yourself, and here is the recipe: 400 mM Tris, 10 mM MgCl2 - prepare 40 mL of 1 M Tris and 1 mL of 1 M MgCl2,mix and adjust pH to 9.0 with HCl and fill up with distilled water to 100 mL - store at 4°C)
  3. 0.3 µL BigDye 1.1 (ABI)
  4. 0.15 µL forward primer/reverse primer
  • Mix the 2 mastermixes thoroughly by inverting the sample tubes
  • Centrifuge the mastermixes at 500 rpm for 10s
  • Pipette 5 µL of the forward-primer mastermix into each well of a 96-well plate and repeat this procedure with the reverse-primer mastermix into each well of a second 96-well plate (prepare and label two 96-well plates; forward and reverse)
  • Add 1 µL of your sample DNA into the corresponding well
  • Close the 96-well plate (the correct closure is important, in order to avoid evaporation of the mastermix during the BigDye-PCR)
  • Transfer the samples into the PCR-machine (TProfessional – Biometra, Germany).
  • Start the BigDye PCR program (see list above) in order to initiate the PCR and the amplification of the target gene
  • After the PCR you can store the samples in a +4°C fridge before the cleaning process is initiated

Cleaning of the BigDye PCR products

This step is important in order to remove the excessive PCR buffer and to gain the purified PCR product. By the addition of paramagnetic beads, which bind the DNA products, and the transfer into magnetic plates, the residual buffer products can be easily removed without removal of the amplified DNA.

  • Premix 3200µL EtOH (85%) with 250µL CleanSeq (Agencourt / Beckman Coulter Genomics, Grenoble, France) for each 96-well plate you have got
  • Pipette 33.5µL of this cleaning solution into each well of your plates
  • Close the plates with a plate lid
  • Vortex the plates in order to mix the BigDye PCR products with the cleaning solution
  • Centrifuge the plates for 1 minute at 500rpm
  • Transfer the 96-well plates into magnetic plates for one hour
  • Afterwards thoroughly remove the liquid in each well without removing the plates off the magnetic plates
  • Add 100µL of EtOH (85%) to each well in order to clean the immobilized metal beads
  • Remove the EtOH after 1 minute of incubation time without removing the 96-well plates from the magnetic plates
  • Detach your sample plates from the magnetic plates and transfer them into a +70°C heater, for at least 10 minutes, to let evaporate the residual EtOH
  • Seal the plates with an aluminum plate coverage and label both, the plates and the corresponding coverage, with a unique identifier
  • The plates can now be stored in a fridge, or even at room temperature for at least one week, before they are transferred to the sequencing center

Primers



Tails

♦ our M13f = universal T7Promoter(F) 5' TAA TAC GAC TCA CTA TAG GG 3'

♦ our M13R = universal T3(R) 5' ATT AAC CCT CAC TAA AG 3'


Specific short fragment oligos

♦ Limbo 363F: gga yta aga gga ata ccy cga cg (works with Pat)

♦ Limbo 466F: taa tat tta ttt ata tta ttt gag aag ctt tta t (works with Pat)

♦ Limbo 535F: caa cyt caa ttg aat gat tcc aac (works with Pat)

From the Hebert lab short Barcoding fragment:

♦ MiniF GAAAATCATAATGAAGGCATGAGC

♦ MiniR TCCACTAATCACAARGATATTGGTAC

Mitochondrial DNA

Primer name (* internal sequencing only) F/R Primer sequence (fragment number) Reference
Cytochrome C Oxidase subunit I, Cox1 5’
LCO1490 (=LCO CCBD) F GGT CAA CAA ATC ATA AAG ATA TTG G Folmer et al, 1994
HCO2198 (=HCO CCBD) R TAA ACT TCA GGG TGA CCA AAA AAT CA Folmer et al, 1994
General BC oligo for many groups: LCO1490-JJ F CHA CWA AYC ATA AAG ATA TYG G Astrin & Stüben, 2008
General BC oligo for many groups: HCO2198-JJ R AWA CTT CVG GRT GVC CAA ARA ATC A Astrin & Stüben, 2008
LepF1 F ATT CAA CCA ATC ATA AAG ATA TTG G Hebert et al 2003
LepR1 R TAA ACT TCT GGA TGT CCA AAA AAT CA
Cytochrome C Oxidase subunit I, Cox1 3’
Jerry F CAA CAT TTA TTT TGA TTT TTT GG Simon et al., 1994
Pat R TCC AAT GCA CTA ATC TGC CAT ATT A Simon et al., 1994
Tom1* R* ACRTAATGAAARTGGGCTACWA Ribera et al 2010
Chy* F* TWGTAGCCCAYTTTCATTAYGT Ribera et al 2010
TY-J-1460, tRNA Tyrosine F TAC AAT TTA TCG CCT AAA CTT CAG CC Sperling & Hickey, 1994
Cytochrome C Oxidase subunit II, Cox2 5’
CO2F F GCT CCA CAA ATT TCT GAG CA Simon et al., 1994
George R ATA CCT CGA CGT TAT TCA GA
Cytochrome B, Cob
CB3 F GAG GAG CAA CTG TAA TTA CTA A Barraclough et al., 1999
CB4 R AAA AGA AA(AG) TAT CAT TCA GGT TGA AT Barraclough et al., 1999
small-subunit rRNA, 12S
12S ai F AAA CTA GGA TTA GAT ACC CTA TTA T Simon et al., 1994
12S bi R AAG AGC GAC GGG CGA TGT GT Simon et al., 1994
large-subunit rRNA, 16S
16s aR (=M14) F CGC CTG TTT AAC AAA AAC AT Simon et al., 1994
ND1 A (=M223) R GGT CCC TTA CGA ATT TGA ATA TAT CCT Simon et al., 1994
16S-1472-JJ F GGT CCT TTC GTA CTA A Astrin & Stüben, 2008
16S-ar-JJ R CRC CTG TTT ATT AAA AAC AT Astrin & Stüben, 2008
NAD1
mt30 R GTA GCA TTT TTA ACT TTA TTA GAA CGG AAC G Simon et al., 1994
Rhantus cob3-mt30_intF1* F GGT AAA AAA CTY TTT CAA GCY AAA TAT AT Balke et al., 2009
Rhantus cob3-mt30_intF2* R CAA GCT AAA TAT ATT AAC TTA TCA TAC CG Balke et al., 2009


Nuclear DNA

Primer name (* internal sequencing only) F/R Primer sequence (fragment number) Reference
18S
18S 5' F GAC AAC CTG GTT GAT CCT GCC AGT Shull et al., 2001
18S b5.0 R TAA CCG CAA CAA CTT TAA T Shull et al., 2001
Arginine Kinase, AK
AK183F F GAT TCT GGA GTC GGN ATY TAY GCN CCY GAY GC Wild & Maddison, 2008
AK939R R GCC NCC YTC RGC YTC RGT GTG YTC Wild & Maddison, 2008
Carbamoyl Phosphate Synthetase 2, CAD
CD439F F TTC AGT GTA CAR TTY CAY CCH GAR CAY AC Wild & Maddison, 2008
CD688R R TGT ATA CCT AGA GGA TCD ACR TTY TCC ATR TTR CA Wild & Maddison, 2008
CD667F F GGA TGG AAG GAA GTD GAR TAY GAR GT Wild & Maddison, 2008
CD851R R GGA TCG AAG CCA TTH ACA TTY TCR TCH ACC AT Wild & Maddison, 2008
CD821F F AGC ACG AAA ATH GGN AGY TCN ATG AAR AG Wild & Maddison, 2008
CD1098R2 R GCT ATG TTG TTN GGN AGY TGD CCN CCC AT Wild & Maddison, 2008
Elongation Factor 1α, EF1α
M44-1 (5' of long fragment) F CAG GAA ACA GCT ATG ACC CAC AT(CT) AAC ATT GTC GT(CG) AT(CT) GG Cho et al., 1995
rcM4 (3' of long fragment) R TGT AAA ACG ACG GCC AGT ACA GC(CGA) AC(GT) GT(TC) TG(CT) CTC AT(AG) TC Cho et al., 1995
efs372 F CTG GTG AAT TTG AAG CYG GTA McKenna et al., 2005
efa754 R CCA CCA ATT TTG TAG ACA TC Normark et al., 1999
EF1a Rhantus F1* F GTA TTG GAA CAG TAC CAG TC Balke et al., 2009
EF1a Rhantus R1* R CAC CAG TTT CAA CAC GAC CG Balke et al., 2009


For3 F GGY GAC AAY GTT GGT TTY AAY Danforth et al. (1999) -- used by Miller & Bergsten Gyrinidae / Dytiscidae
Cho10 R ACR GCV ACK GTY TGH CKC ATG TC Danforth et al. (1999) -- used by Miller & Bergsten Gyrinidae / Dytiscidae


Enolase, En
EN37F F GAC TCT CGT GGN AAY CCN ACN GTN GAG GT Wild & Maddison, 2008
EN731R R CTT GTA GAA CTC NGA NGC NGC NAC RTC CAT Wild & Maddison, 2008
Histone 3, H3
H3aF F ATG GCT CGT ACC AAG CAG AC(AcG) GC Colgan et al., 1998
H3aF sequence with ambiguity code F ATG GCT CGT ACC AAG CAG ACV GC Colgan et al., 1998
H3aF used by Bergsten and Miller F ATGGCTCGTACCAAGCAGACGGC Colgan et al., 1998
H3aR R ATA TCC TT(AG) GGC AT(AG) AT(AG) GTG AC Colgan et al., 1998
H3aR used by Bergsten and Miller R ATATCCTTGGGCATGATGGTGAC Colgan et al., 1998
Histone 4, H4
H4F2s F TSC GIG AYA ACA TYC AGG GIA TCA C Pineau et al, 2004
H4F2er R CKY TTI AGI GCR TAI ACC ACR TCC AT Pineau et al, 2004
Wingless, Wg
LepWg1 F GAR TGY AAR TGY CAY GGY ATG TCT GG Brower & Egan, 1997
LepWg2a R ACT ICG CAR CAC CAR TGG AAT GTR CA Brower & Egan, 1997
Wg550F F ATG CGT CAG GAR TGY AAR TGY CAY GGY ATG TC Wild & Maddison, 2008
WgAbRZ R CAC TTN ACY TCR CAR CAC CAR TG Wild & Maddison, 2008
RNA Polymerase 2, RNA Pol 2
PL527F F AAYAAACCVGTYATGGGTATTGTRCA Wild & Maddison, 2008
PL758R R ACGACCATAGCCTTBAGRTTRTTRTAYTC Wild & Maddison, 2008



Wnt WgDytF15 For CGY CTT CCW TCW TTC CGW GTY ATC

Wnt WgDytR15 Rev CCG TGG ATR CTG TTV GCH AGA TG


PL625R CCCATGACTAGYTCNCCRTGYTCNACCAT



RNAPol_F2_709F GTCATAGAGGTAATCCARAARGCNCAYAAYATGGA

RNAPol_F2_982R AARATYTTYTGYACRTTCCARATCAT


RNAPol_F3_859F CGTCTGATCAAGGCTATGGARTCNGTNATGGT


RNAPol_F3_1097R CCAGCGAAGTGGAAVGTRTTNAGBGTCATYTG


5Miller (2003).

References


Astrin JJ, Stuben PE (2008), Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera : Curculionidae). Invertebrate Systematics Volume: 22 Issue: 5 Pages: 503-522.

Balke M, Ribera I, Miller MA, Hendrich L, Sagata K, Posman A, Vogler AP and Meier R (2009), New Guinea highland origin of a widespread arthropod supertramp. Proc. R. Soc. B 2009 276, 2359-2367.

Barraclough TG, Hogan JE, Vogler AP (1999) Testing whether ecological factors promote cladogenesis in a group of tiger beetles (Coleoptera: Cicindelidae). Proc. R. Soc. Lond. B 266: 1061-1067.

Brower AVZ and Egan MG (1997), Cladistic analysis of Heliconius butterflies and relatives (Nymphalidae: Heliconiiti): a revised phylogenetic position for Eueides based on sequences from mtDNA and a nuclear gene. Proc. R. Soc. Lond. B Bio. Volume: 264 Issue: 1384 Pages: 969-977.

Cho S, Mitchell A, Regier JC, Mitter C, Poole RW, Friedlander TP and Zhao S (1995), A Highly Conserved Nuclear Gene for Low-Level Phylogenetics: Elongation Factor-1α Recovers Morphology-based Tree for Heliothine Moths. Mol. Biol. Evol. Volume: 12 Issue: 4 Pages: 650-656.

Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, et al. (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Aust J Zool 46: 419-437.

Danforth, B.N., Sauquet, H. & Packer, L. 1999. Phylogeny of the bee genus Halictus (Hymenoptera: Halictidae) based on parsimony and likelihood analyses of nuclear EF-1alpha sequence data. Molecular Phylogenetics and Evolution, 13, 605-618.

Folmer O, Black M, Hoeh W, Lutz R and Vrijenhoek R (1994), DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol., 3 (1994), pp. 294–299.

Hebert PDN, Cywinska A, Bal S, Dewaard JR (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London (B) 270: 313–321. https://doi.org/10.1098/rspb.2002.2218

McKenna DD and Farrell BD (2005), Molecular phylogenetics and evolution of host plant use in the Neotropical rolled leaf ‘hispine’ beetle genus Cephaloleia (Chevrolat) (Chrysomelidae: Cassidinae). Mol. Phylogenet. Evol. 37, 117–131.

Normark, BB, Jordal, BH and Farrell, BD (1999), Origin of a haplodiploid beetle lineage. Proc. R. Soc. Lond. B Bio. 266, 2253–2259.

Pineau, P. et al. A universal primer set for PCR amplification of nuclear histone H4 genes from all animal species. Mol. Biol. Evol. 22, 582–588 (2005).

Ribera I, Fresneda J, Bucur R, Izquierdo A, Vogler AP, Salgado JM, Cieslak A (2010) Ancient origin of a Western Mediterranean radiation of subterranean beetles. BMC Evolutionary Biology 10: 29. https://doi.org/10.1186/1471-2148-10-29

Shull VL, Vogler AP, Baker MD, Maddison DR, Hammond PM (2001) Sequence Alignment of 18S Ribosomal RNA and the Basal Relationships of Adephagan Beetles: Evidence for Monophyly of Aquatic Families and the Placement of Trachypachidae. Syst Biol 50: 945-969.

Simon C, Frati F, Beckenbach AT, Crespi B, Liu H, et al. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87: 651-701.

Sperling FAH, Hickey DA (1994), Mitochondrial DNA sequence variation in the spruce budworm species complex (Choristoneura: Lepidoptera). Mol. Biol. Evol. 11: 656-665.

Wild AL, Maddison DR (2008) Evaluating nuclear protein-coding genes for phylogenetic utility in beetles. Mol Phylogenet Evol 48: 877-891.